Wähle Deinen Hintergrund: Wähle Deinen Hintergrund: Registriere Dich, um Deine Auswahl zu speichern Schließen
Store Donate
Huntington's Disease Youth Organization

Das Gen der Huntington Krankheit: Unter dem Mikroskop

HDYO verfügt auf unserer Seite über mehr Informationen über die Huntington Krankheit, die für junge Leute, Eltern und Profis geeignet sind:

www.hdyo.org

Die Huntington Krankheit wird durch eine Verlängerung in einem bestimmten Gen in der DNA eines Menschen verursacht. Dieser Artikel erklärt das besagte Gen und wirft einen Blick auf diese „Verlängerung“. Wir werden auch anhand von Familienstammbäumen zeigen, wie das Gen geerbt und weitervererbt wird.

Gene, Chromosomen und DNA

DNA, chromosomes and genes

Lasst uns zuerst auf ein paar Grundlagen eingehen, beginnend mit der DNA. Die DNA ist der Name der chemischen Substanz, aus der unsere Gene aufgebaut sind. Die Buchstaben “DNA” stehen für Deoxyribonucleic Acid bzw. auf Deutsch Desoxyribonukleinsäure (fesselnd, nicht wahr?). Es ist nicht verwunderlich, dass wirklich niemand den vollständigen Namen verwendet - DNA ist viel einfacher auszusprechen und zu merken.

DNA ist das, was wir von unseren Eltern geerbt haben, die wiederum ihre von ihren Eltern geerbt haben und so weiter. Unsere DNA entscheidet, wer wir sind, wie wir aussehen und wie wir wachsen. Dinge wie unsere Haarfarbe, Augenfarbe, Größe, ob wir männlich oder weiblich sind und sogar Aspekte unserer Persönlichkeit werden alle durch unsere DNA entschieden.

DNA ist der Name der chemischen Substanz, aber Gene sind das, was wir die Anweisungen nennen, die in der DNA gespeichert sind. Wir haben viele Gene – etwa 23.000 Gene in den Zellen unseres Körpers, um genau zu sein. Jedes Gen ist ein Satz aus Anweisungen - wie ein Rezept. Ein Gen erklärt der Zelle, wie eine Substanz, die Protein genannt wird, zu bilden ist. Proteine sind die Maschinen, die alle wichtigen Dinge in unseren Zellen machen, angefangen von chemischen Reaktionen bis zum Weiterleiten von Mitteilungen von einer Zelle zur anderen.

Gene werden aufgereiht wie Würstchen und verpackt in Dinge, die Chromosomen genannt werden. Es gibt insgesamt 46 Chromosomen. 23 kommen von einem Elternteil und 23 kommen vom anderen. Jede Zelle in unseren Körpern enthält eine Kopie aller 46 Chromosomen.

Genetische Veränderungen: Das Gen der Huntington Krankheit

Mit diesen Grundlagen lasst uns einen Blick auf das Gen der Huntington Krankheit werfen. Manchmal entstehen Veränderungen (von den Forschern „Mutationen“ genannt) innerhalb der Chromosomen oder Gene. Diese Änderungen können die Art und Weise verändern, wie der Körper arbeitet und genetische Störungen verursachen. Selbst eine winzige Änderung im Gen kann eine dramatische Veränderung im Protein verursachen. Stelle dir ein Rezept vor, das dem Koch erklärt, einen Auflauf für 400 Minuten zu kochen anstelle von 40, und du wirst eine Idee davon bekommen, wie selbst kleine Änderungen in der Schreibweise in unseren Genen große Probleme verursachen können.

IN 1993 ENTDECKTE EIN FORSCHERNTEAM DAS GEN, das für die Huntington Krankheit verantwortlich ist, auf Chromosom 4. Sie fanden heraus, dass ein Teil des Gens sich immer und immer wieder wiederholte, wie ein Stottern oder wenn du eine Taste auf der Taaaaaaaaaaaaaaaaaaaaaaaaastatur auf einem Computer zu lange nach unten drückst. Diese Wiederholung verursacht die Entwicklung der Huntington Krankheit und ist als ‘CAG Wiederholung’ bekannt.

Was ist eine ‘CAG Wiederholung’?!

CAG repeats

Falls Du dich fragst, warum das Stottern im Huntington Gen eine CAG Wiederholung genannt wird: Nun, ebenso wie ‘DNA’, ist CAG eine Abkürzung für einige komplizierte wissenschaftliche Wörter. Im Allgemeinen besteht DNA aus vier Basen, die als Adenin (abgekürzt A), Cytosin ©, Guanin (G) und Thymin (T) bekannt sind. Diese Basen sind der Code hinter all unserer DNA und Genen. Jedes Gen hat einen unterschiedlichen Code und, na ja, Wissenschaftler sind faul und wollten nicht ständig alle diese schwierigen Wörter ausschreiben, also verwenden sie nur die Abkürzungen. So sind die vier DNA-Basen als A, C, G und T bekannt. Falls also jemand einen Gencode ausschreiben müsste, würde es so ähnlich ausschauen wie: AAGTCCTGACTGGGACCTTGAGA CCTAG.

Falls ein Gen wie ein Rezept ist, dann sind die Basen wie das Alphabet der Buchstaben, aus denen die Anweisungen im Rezept bestehen. Gene verwenden ein nur sehr einfaches Alphabet mit vier Buchstaben, aus denen ausgewählt wird. Dabei aber ist die Schreibweise sehr wichtig.

Das Gen, das die Huntington Krankheit verursacht, enthält einen Abschnitt, in dem die Basen C, A und G viele Male wiederholt werden – die ‘CAG Wiederholung’. Die meisten Kopien des Gens enthalten zwischen 10 und 20 Wiederholungen, aber manchmal nimmt die Zahl der Wiederholungen zu, und dann fangen die Probleme an.

CAG Wiederholungen

Jeder Mensch hat zwei Kopien des Gens der Huntington Krankheit, egal ob er das Risiko für die Huntington Krankheit hat oder nicht. Jeweils eine Kopie wurde von jedem Elternteil geerbt. Und jedes Gen der Huntington Krankheit enthält eine CAG Wiederholung.

Was die Entwicklung der Krankheit verursacht, ist die Zahl der CAG Wiederholungen. Vereinfacht gesagt haben Leute, die die Huntington Krankheit entwickeln, längere CAG Wiederholungen als die, die dies nicht tun. Um der Sache leichter folgen zu können, teilen wir die CAG Wiederholungen in vier verschiedene Bereiche auf. Nur eine der beiden Kopien muss verlängert sein, um Probleme zu verursachen.

26 und weniger (nicht betroffener Bereich)

Wie wir erwähnten, hat jeder eine CAG Wiederholung in seinem Gen der Huntington Krankheit (sogar diejenigen, die aus einer Familie kommen, die nicht von der Huntington Krankheit beeinflusst ist). Die meisten Leute, die die Huntington Krankheit nicht haben, haben um die 10 - 20 CAG Wiederholungen. Tatsächlich ist alles bis 26 CAG Wiederholungen in Ordnung und wird keine Probleme verursachen. Aber sobald du darüber gehst, könnte es Komplikationen geben.

40 Wiederholungen und höher (Krankheitsbereich)

Jeder mit 40 CAG Wiederholungen oder höher wird leider mit Sicherheit die Huntington Krankheit in seinen Lebzeiten entwickeln, mit einem 50 % Risiko, das Gen zudem an jedes seiner Kinder weiterzugeben. Die meisten Menschen mit der Huntington Krankheit haben eine CAG Wiederholung zwischen 40 und 50.

Wiederholungen im mittleren Bereich zwischen 27 und 39 sind sehr selten. Ihre Bedeutung ist nicht ganz so eindeutig, und tatsächlich verstehen Wissenschaftler sie nicht völlig, also nennt man sie manchmal den ‘Graubereich’.

27 - 35 CAG Wiederholungen (Risiko für zukünftige Generationen)

Die gute Nachricht über Wiederholungen zwischen 27 und 35 ist, dass die Personen mit 27-35 Wiederholungen die Huntington Krankheit nicht selbst entwickeln werden. Jedoch gibt es ein kleines Risiko (um 5 %), dass die Kinder dieser Personen Risikopersonen der Huntington Krankheit sein könnten. Dies kommt daher, daß die Zahl der Wiederholungen bei der Weitervererbung an ein Kind so zunehmen kann, dass dieses Kind dann so viele Wiederholungen hat, dass sich die Huntington Krankheit entwickelt.

36 - 39 CAG Wiederholungen (verringerte Eintrittswahrscheinlichkeit)

Menschen mit Wiederholungen in diesem Bereich können die Huntington Krankheit entwickeln müssen dies aber nicht . Menschen in diesem Bereich könnten Symptome der Huntington Krankheit in einem höheren Alter entwickeln. Manchmal ist das dann so spät im Leben, dass sie am hohen Alter sterben können, bevor mögliche Symptome anfangen. Jedoch ist das Risiko der Weitergabe der Erkrankung an ein Kind in diesem Bereich immer noch 50 %. Wissenschaftler nennen diese Unvorhersehbarkeit ‘verringerte Penetranz (Eintrittswahrscheinlichkeit)’.

Das ‘verlängerte‘ Gen der Huntington Krankheit erben

Unterm Strich: Falls das Gen der Huntington Krankheit zu viele CAG Wiederholungen hat, verursacht es die Huntington Krankheit. Lasst uns nun betrachten, wie Menschen dieses verlängerte Gen erben, und wie die Huntington Krankheit in Familien weitergegeben werden kann.

Das 50 % Risiko

50% risk

Menschen bekommen die Huntington Krankheit, indem sie das verlängerte Gen von einem Elternteil erben. Weil wir eine Kopie jedes Chromosoms von jedem Elternteil erben, haben wir letztendlich zwei Kopien jeden Gens - eine von der Mutter und die andere vom Vater.

Also hat eine Person mit der Huntington Krankheit zwei Kopien des Gens der Huntington Krankheit, von denen eine verlängert ist (mit vielen CAG Wiederholungen) und eine andere, die normal ist.

Eine Person ohne Huntington Krankheit hat auch zwei Kopien des Gens der Huntington Krankheit, beide sind allerdings normal.

Somit hat ein Kind mit einem Elternteil, das die Huntington Krankheit hat, ein normales Gen vom nicht betroffenen Elternteil, aber könnte entweder das verlängerte Gen oder das normale von dem Elternteil mit der Huntington Krankheit geerbt haben.

Daraus ergibt sich das 50% Risiko, das verlängerte Gen geerbt zu haben.

Technisch gibt es vier mögliche Ergebnisse für die Weitergabe der Gene (wie die Abbildung hervorhebt). Zwei dieser Ergebnisse enden damit, dass das Kind das erweiterte Gen hat und bei den anderen beiden nicht - also ist die Wahrscheinlichkeit 50 %. Aber, um die Sache leichter verständlich zu machen, kannst du das Elternteil, das die Huntington Krankheit nicht hat, einfach streichen und nur betrachten, ob das Kind das verlängerte Gen oder das normale von dem Elternteil mit der Huntington Krankheit erbt. Auf jeden Fall ist es immer ein 50 % Risiko.

Ob eine Person das verlängerte oder das normale Gen erbt ist reiner Zufall, und deshalb sagen manche Leute, das Risiko für die Huntington Krankheit sei wie der Wurf einer Münze. Jeder Einzelne hat sein eigenes 50 % Risiko, somit ist es so, als würde jeder seine eigene Münze werfen in Bezug auf sein eigenes Risiko.

Die 25 % Wahrscheinlichkeit

25% grandchild risk

Für Einige ist das Risiko nicht ganz klar 50 %. Falls beispielsweise ein Großelternteil eines Kindes die Huntington Krankheit hat, aber das Elternteil des Kindes als Risikoperson nicht getestet wurde, dann hat das Kind eine 25 % Wahrscheinlichkeit, das Gen geerbt zu haben.

Das liegt daran, dass wir nicht wissen, ob das Elternteil das verlängerte Gen hat oder nicht. Wenn das Elternteil das verlängerte Gen hätte, dann wäre das Risiko des Kindes 50 %.

Wenn das Elternteil das verlängerte Gen nicht hätte, dann würde das Risiko von 25 % auf 0 % gehen – das bedeutet, es gibt überhaupt kein Risiko für das Kind. Alles hängt tatsächlich davon ab, welches Gen das Elternteil geerbt hat. Bis wir dies wissen, hat das Kind ein Risiko von 25 %.

Autosomal dominant

Falls eine Person ein verlängertes Gen und ein normales Gen hat, wie kommt es dann, dass das verlängerte Gen,die Kontrolle übernimmt und die Huntington Krankheit verursacht? Warum schlägt das normale Gen nicht zurück? OK, betrachten wir den Ausdruck ‘autosomal dominant’. Leider ist die Huntington Krankheit eine ‘autosomal dominante Krankheit, was bedeutet, dass nur eine verlängerte Kopie der zwei Gene ausreicht, um die Krankheit zu verursachen. Mit anderen Worten, diese verlängerte Kopie dominiert über das andere normale Gen. Aus diesem Grund ist nur ein verlängertes Gen nötig, um die Krankheit zu verursachen, anstatt zwei.

Zusammengefasst hat dieser Abschnitt erklärt, dass das Gen, das die Huntington Krankheit verursacht, verlängert ist, weil es zu viele ’CAG Wiederholungen’ hat, und dass diese CAG Wiederholungen in vier Bereiche aufgeteilt werden. Wir haben auf das Risiko beim Erben der Huntington Krankheit geschaut, und wie dies funktioniert. Und trotz einiger schwieriger Begriffe wie ’autosomal dominant’ haben wir hoffentlich mehr erklärt als verwirrt. Falls du irgendwelche Fragen hast, zögere nicht und verwende bitte den STELLE EINE FRAGE Abschnitt, wo die Experten ausgezeichnete Antworten bereitstellen oder alternativ KONTAKTIERE HDYO direkt, falls du etwas Persönliches fragen willst.